|
Strains
The
following standard E.
coli strains were used in this study:
- MG1655 ΔLacI (Datsenko, 2000)
- MC4100Z1
Plasmids
The pZ
series of plasmids developed by Lutz and Bujard (1997) were used
in
this study. More specifically, pZS22-YFP plasmids were used
in this study where S indicates that the plasmid produces less than 10
copies per cell (pSC101 origin of replication), 22 indicates that the
plasmid harbors a kanamycin resistance gene (30 ug/ml kanamycin was
present in all media used to grow cells harboring this plasmid or its
derivatives) and a PLlac-O1
promoter.
The
promotor harbored by the plasmid was altered in this study.
The sequences of the two promoters used in this study are
given below. The blue
region of each sequence indicates the
O1 operator site where LacI binds the DNA and the red sites
represent
the -10 and -35 binding sites for the σ70 subunit of RNA
polymerase.
O1-LacUV5
promoter construct:
5' AATTGTGAGCGGATAACAATTTACACTTTATGCTTCCGGCTCGTATAATGTGT 3'
LacUV5-O1
promoter construct:
5' TTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAA CAATT
3'
The
LacUV5 promoter was used by Müller-Hill in experiments to
evaluate the role of operator spacing in repression at the Lac operon (1996).
This promoter was used in this study because it has a
reasonable level of basal activity and high induced activity -- this
property is useful when a measurable ratio of induced and
non-induced signals is desired.
For
the purpose of ligating the constructs into a plasmid, each of the
above conostructs was designed with restriction sites overhanging the
5' (XhoI) and 3' (EcoRI) ends.
Back to Top.
Ordering DNA
All
DNA was ordered through Integrated DNA Technologies, Inc.
Back to Top.
Sequencing DNA
DNA
sequencing was conducted at the Sequence Analysis Facility of the
California Institute of Technology.
The
following primer was ordered and used to sequence the promoter region
of the plasmids used in this study:
5'
AATTCCGACGTCTAAGAAACCATT 3'
Back to Top.
Running a Gel
1.5% (wt/vol)
agarose gels were used in all DNA gel electrophoresis unless noted as
otherwise. Gels were run at 120V in the presence of ethidium
bromide except where noted as otherwise. These conoditions
were used for analytic gels and for gel purification of samples. Gels were typically run in TAE running buffer.
Back to Top.
Gel Extraction
Once a
DNA sample of interest was isolated as a band on an electrophoretic
gel, it was excised using a clean razor blade and the DNA was purified
using a gel extraction kit from Qiagen.
Back to Top.
Plasmid Digests
Plasmids
were digested in two steps using XhoI and EcoRI from New England
Biolabs.
Each
reaction mixture was incubated at 37°C
for a period of one hour. Reaction mixtures were
composed of a DNA sample suspended in 1X (final
concentration) of the provided buffer
diluted in nuclease free water to a total volume of 50 ul. 2
ul of the provided enzyme stock were used in each reaction (~4 units).
Following the one hour of incubation, samples were purified
using a PCR purification kit from Qiagen and subsequently suspended in
the appropriate buffer for the next digest or, in the case of no
following digest, nuclease free water.
Approximately
2 ug of total plasmid DNA were used in each plasmid digest (the typical yield of pZS plasmid from a
mini-prep).
Back to Top.
Plasmid Purification
Plasmids
were purified using mini prep or midi prep kits from Qiagen.
Standard procedures were followed for preparation of plasmid
DNA. One modification of the midi prep protocol was implemented in
which the sample was centrifuged for 8 minutes at 8,000 rpm following
the addition of buffer N3, and the supernatant was then used in subsequent steps of the protocol. All
samples submitted for sequencing were obtained using a midi-prep kit
and samples using for DNA ligation and digestion were obtained using a
mini prep kit.
Back to Top.
Ligation
DNA
ligation was carried out using a Rapid DNA Ligation kit from
Promega. 1 and 2 ul of 10X dilution in nuclease free water of insert (annealed primer mixture, see
below), with a concentration of approximately 208 ng/ul, and 5 ul vector
(digested plasmid, see above), with a concentration of approximately 28.8
ng/ul, were used in each reaction. All DNA concentrations were
measured using a NanoDrop spectrophotometer. The ligation
reaction was allowed to take place for 10 minutes. Following
this incubation period, the ligated DNA was purified using a PCR
purification kit from Qiagen.
Back to Top.
Electroporation
Electrocompotent
cells (~ 50 ul) were transformed using 2 ul of a 10X dilution in
nuclease free water of each of the ligated plasmid solutions.
Transformation was completed using standard electroporation
equipment at a voltage of 2.5 kV giving a time constant greater than 3. Following the electroporation, which was done
in a standard electroporation cuvette, samples were incubated
in this cuvette in 1 ml SOC medium at 37°C for 45 minutes prior
to plating the samples.
150 ul
of each sample was plated onto LB plates supplemented with 30 ug/ml
kanamycin using sterile glass ColiRoller beads. The unused
cell suspension was kept at room temperature. If no growth
was observed on the plates following the first day of incubation,
the remainder of the cell suspensions was plated.
Three
isolated colonies were selected from each plate on which growth was
observed. Plasmids were purified using cultures grown from each
colony and sequenced; glycerol stocks were also prepared from each colony.
When
cells were transformed with a plasmid obtained using a mini prep or a midi prep kit, 1 ul of this mixture
was used in the electroporation and 50 ul of the cell suspension was
plated onto LB plates supplemented with kanamycin.
Back to Top.
Annealing Primers
Primers
were ordered from IDT technologies in pairs such that the members of
each pair would anneal to each other to form the constructs given above
with an XhoI digest sticky end at the 5' end and an EcoRI sticky end at
the 3' end. Primers were resuspended in STE buffer to a final
concentration of 100 pmol/ul when obtained from IDT.
The
primers were anealed as follows:
- Mix together 5 ul of each
resuspended oligomer
- Incubate samples using a
thermocycler at 95°C for 5 minutes, 55°C for 3 minutes
and end at 25°C.
- Store samples at
-20°C.
Back
to
Top.
Preparing
Compotent
Cells
Electrocompotent
cells were prepared following standard protocols in molecular biology.
In short, a 1 L culture was inoculated using an overnight 25
mL culture in low salt LB and grown to an optical density of 0.7 in low
salt LB. The culture was then chilled on ice for 30 minutes
and cells were harvested by centrifugation. Cells were then
washed four times in 10% glycerol and finally resuspended in 2 mL 10%
glycerol. The cells were then distributed as 50 ul alequotes
into 0.65 ml Eppendorf tubes and immediately placed in -80°C
storage.
Back to Top.
Bulk
Fluorescence
Measurements
Expression
of YFP was measured in bulk using a plate reader with Costar
black 96 well plates (~0.5 mL well volume) having clear bottoms.
Fluorescence was measured from the bottom of the plate.
Emission wavelength was set to 500 nm with a band width of 20 nm and
excitation was measured at 535 nm with a band width of 20 nm.
The optical density at 600 nm was also measured using the
plate reader.
For
bulk fluorescence measurements, 5 ml MCG medium (supplemented with
antibiotic as appropriate) was inoculated to an optical density of 0.01
(~ 10 ul) using cells from an overnight culture. These were then incubated with shaking at 37°C until an OD600
of around 0.1 was reached. At this point, 200
ul samples of each culture were evaluated using the plate reader.
Back to Top.
Preparing
Glycerol
Stocks
Stocks
were prepared in duplicate for all transformed cells.
Colonies isolated on agar plates were used to inoculate 5 ml LB.
These cultures were then allowed to grow overnight; then 0.5
ml was combined with 0.5 ml 50% glycerol in screw-cap cryotubes and
these solutions were then immediately placed in -80°C storage
for later use.
Back to Top.
|